logo

МЕТОДЫ

Главная

Род Alternaria

Идентификация

Литература

Методы

Полезные ссылки

Сотрудничество

Aвтор проекта

  • Питательные среды
  • Специфичные праймеры для ПЦР


    Питательные среды

          Картофельно-морковный агар (КМА, PCA): 20 г белого картофеля, 20 г моркови, 20 агара; автоклавировать нарезанные овощи в небольшом количестве воды 20-30 мин. Пропустить суспензию через мелкое сито (не для фильтрации), разбавить суспензию до 1 л дистиллированной водой. Добавить агар, стерилизовать; рН не измеряется.
          КМА чаще других используется для изучения морфологии и идентификации видов в качестве стандартной питательной среды
          Simmons E.G. Alternaria. An Identification Manual (2007). The Netherlands, Utrecht: CBS. 775 pp.

          Возможно приготовление КМА альтернативным способом: 20 г тёртого картофеля и 20 г тёртой моркови варить в течение часа в 500 мл водопроводной воды. Пропустить через мелкое сито. В кастрюле добавить 20 г агара к 500 мл воды. Когда агар разойдётся, добавить процеженную жидкость и перемешать. Перелить в банку и стерилизовать 20 мин. при 121°С.
          Hawksworth D.L., Kirk P.M., Sutton B.C., Pegler D.N. Ainsworth and Bisby`s Dictionary of fungi. 8th edition. CAB International, 1995. 616 pp.

          Сенной агар: 50 г сухой перезимовавшей соломы и листьев злаков. Автоклавировать в 1 л дистиллированной воды 30 мин. Отфильтровать через несколько слоёв марли. Довести объём фильтрата до 1 л. Добавить 2 г двузамещённого фосфорнокислого калия и 20 г агара. Автоклавировать 10 мин. Довести рН до 6,0-6,5. Автоклавировать.
          Среда с отваром сена чаще всего используется при изоляции Alternaria spp., т.к. колонии в таких условиях обычно формируют обильное спороношение и скудный вегетативный мицелий.
          Simmons E.G. Alternaria. An Identification Manual (2007). The Netherlands, Utrecht: CBS. 775 pp.

          V-8: 175 мл готовой смеси овощных соков V8, 3 г карбоната кальция, 20 г агара; довести дистиллированной водой до 1 л. Стерилизовать 30 мин. при 110°С (рН около 6,4).
          Часто используется для изучения морфологии и идентификации видов, обладающих низкой интенсивностью спороношения в условиях чистой культуры. Может быть использована для получения небольших количеств инокулюма.
          Simmons E.G. Alternaria. An Identification Manual (2007). The Netherlands, Utrecht: CBS. 775 pp.

          V-4: 150 мл соковой смеси, включающей соки свёклы, сельдерея, моркови и томата в соотношении 4:3:2:1, 3 г карбоната кальция, 850 мл воды и 20 г агара. Стерилизовать как V-8.
          Используется также как и V-8. Концентрация соковой смеси может быть изменена в широких пределах (10-50%).
          Состав среды: Михайлова Л.А., Гоголева С.Г., Гультяева Е.И. (2002) Взаимодействие штаммов Bipolaris sorokiniana и образцов пшеницы // Микология и фитопатология 36 (2): 63-66.
          Использование для Alternaria: Ганнибал Ф.Б. (2007) Токсигенность и патогенность грибов рода Alternaria для злаков // Лаборатория микологии и фитопатологии им. А.А.Ячевского ВИЗР. История и современность. Под ред. А.П.Дмитриева. СПб. С. 82-93.

          DRYES: 20 г дрожжевого экстракта, 150 г сахарозы, 1,0 мл дихлорана (0,2% в этаноле), 0,5 мл бенгальского розового (5%), 0,1 г хлорамфеникола, 20 г агара; довести водой до 1 л. Стерилизовать, довести рН до 5,6.
          Используется для изучения культурально-морфологических свойств и идентификации видов по культуральным признакам.
          Состав среды: Frisvad J.C. (1983) A selective and indicative medium for groups of Penicillium viridicatum producing different mycotoxins in cereals // J. Appl. Bacteriol. 54: 409-416.
          Использование для Alternaria: Andersen B., Thrane U. (1996) Differentiation of Alternaria infectoria and Alternaria alternata based on morphology, metabolite profiles, and cultural characteristics // Can. J. Microbiol 42: 685-689.

          YES: 20 г дрожжевого экстракта, 150 г сахарозы, 20 г агара, 1 л дистиллированной воды. Стерилизовать.
          Используется также как и DRYES.
          Состав среды: Samson R.A., Hoekstra E.S., Frisvad J.C., Filtenborg O. (2000) Introduction to food- and airborne fungi. 6 edition. The Netherlands, Utrecht: CBS. 389 pp.
          Использование для Alternaria: Gannibal Ph.B., Yli-Mattila T. Cultural and molecular differentiation of small-spored Alternaria species associated with Poaceae // Микология и фитопатология. 2005. Т. 39, вып. 4. С. 13-23.

    наверх


    Специфичные праймеры для ПЦР

          Для выявления и идентификации видов Alternaria в чистой культуре и растительном материале используются методы, основанные на полимеразной цепной реакции (ПЦР). Для этого сконструирован ряд специфичных олигонуклеотидных праймеров.

          Группа близких видов, включающая A. alternata, A. tenuissima, A. arborescens и, вероятно, некоторые другие мелкоспоровые виды
          AAF2/AAR3
          5'- TGCAATCAGCGTCAGTAACAAAT, ATGGATGCTAGACCTTTGCTGAT
          Та=55°С; 340 п.н.
          Konstantinova P., Bonants P.J.M., van Gent-Pelzer M.P.E., van der Zouwen P., van den Bulk R. (2002) Development of specific primers for detection and identification of Alternaria spp. in carrot material by PCR and comparison with blotter and plating assays // Mycol. Res. 106 (1): 23-33.

          комплекс видов 'A. infectoria'
          Ain3F/Ain4R
          5'-CTCGATGTCCGCCTCAGTAG, GAGGATAGCACGGCTGGTAG
          Та=60°С; 327 п.н.
          Gannibal Ph.B., Yli-Mattila T. (2007) Morphological and UP-PCR analyses and design of a PCR assay for differentiation of Alternaria infectoria species-group // Микология и фитопатология 41 (4): 313-322.

          Группа близких видов, включающая A. linicola, A. solani и, вероятно, некоторые другие длинноспоровые виды
          ALP/ITS4
          Та=62°С; 535 п.н.
          5'-GGCACCTCCCGGGGTGGC, TCCTCCGCTTATTGATATGC
          McKay G.J., Brown A.E., Bjourson A.J., Mercer P.C. (1999) Molecular characterisation of Alternaria linicola and its detection in linseed // Europ. J. Plant Pathol. 105 (1): 15-166.

          A. mali
          LinF1/LinR
          5'-TATCGCCTGGCCACCTACGC, TGGCCACGACAACCCACATA
          Та=65°С; 496 п.н.
          Johnson R.D., Johnson L.J., Kohmoto K., Otani H., Lane C.R., Kodama M. (2000) A polymerase chain reaction-based method to specifically detect Alternaria alternata apple pathotype (A. mali), the causal agent of Alternaria blotch of apple // Phytopathol. 90 (9): 973-976.

          A. radicina
          Pa2071/Pa2072
          5'-GGGCGTTATGCGAGATCAGG, GTATTTGTAGGAATTTCCAG
          Та=60°С; ок. 900 п.н.
          Pryor B.M., Gilbertson R.L. (2001) A PCR-based assay for detection of Alternaria radicina on carrot seed // Plant Disease 85 (1): 18-23.
          ARF2/ARR3
          5'-AATCAGCGTCAGTAAACAAACG, AGAGGCTTTGTGGATGCTG
          Та=53°С; 251 п.н.
          Konstantinova P., Bonants P.J.M., van Gent-Pelzer M.P.E., van der Zouwen P., van den Bulk R. (2002) Development of specific primers for detection and identification of Alternaria spp. in carrot material by PCR and comparison with blotter and plating assays // Mycol. Res. 106 (1): 23-33.

          A. brassicae
          ABCsens/ABCrev
          5'-CTGGTGAAAAGGTTGCGATCGT, GTGACTTTCATGAAATGACATTGATG
          Та=60°С; 780 п.н.
          115sens/115rev (для real-time PCR)
          5'-AACCCTATAGACCCACGTCGACTA, GATGGTACGCAAGGCTTGGT
          Та=60°С.
          Guillemette T., Iacomi-Vasilescu B., Simoneau P. (2004) Conventional and real-time PCR-based assay for detecting pathogenic Alternaria brassicae in cruciferous seed // Plant Disease 88 (5): 490-496.

          A. dauci
          ADF2/ADR1
          5'- GCAATCAGCGTCAGTAACAACA, CGCAAGGGGAGACAAAAA
          Та=50°С; 345 п.н.
          Konstantinova P., Bonants P.J.M., van Gent-Pelzer M.P.E., van der Zouwen P., van den Bulk R. (2002) Development of specific primers for detection and identification of Alternaria spp. in carrot material by PCR and comparison with blotter and plating assays // Mycol. Res. 106 (1): 23-33.

    наверх


    Некоторые разделы сайта созданы при поддержке Администрации Санкт-Петербурга